Review



anti tgfβ2 neutralizing antibody  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    R&D Systems anti tgfβ2 neutralizing antibody
    (A) HUVECs were transfected with either control mimic (con) or miR-30b mimic (30b) and levels of TGFβ1 and <t>TGFβ2</t> mRNA were assessed by qRT-PCR. Expression levels relative to control mimic transfected cells and normalized to β-actin expression are presented as the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 expression. * P < 0.05, ** P < 0.01 as determined by unpaired Student’s t -test. (B) Cells were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of TGFβ2 protein levels by western blot. β-actin was used as endogenous control. (C) ELISAs for TGFβ1 and TGFβ2 were performed with 24 hour conditioned supernates from HUVECs transfected with 20 nM of either control or miR-30b mimic. Data represents the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 secretion into cell culture supernate. * P = 0.044 as determined by unpaired Student’s t -test. (D) HUVECs were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of Smad2 phosphorylation by western blot.
    Anti Tgfβ2 Neutralizing Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+tgf%CE%B22+neutralizing+antibody/TGF-beta+2+Antibody/pmc05627931-38-45-55
    Average 92 stars, based on 13 article reviews
    anti tgfβ2 neutralizing antibody - by Bioz Stars, 2026-09
    92/100 stars

    Images

    1) Product Images from "MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2"

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0185619

    (A) HUVECs were transfected with either control mimic (con) or miR-30b mimic (30b) and levels of TGFβ1 and TGFβ2 mRNA were assessed by qRT-PCR. Expression levels relative to control mimic transfected cells and normalized to β-actin expression are presented as the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 expression. * P < 0.05, ** P < 0.01 as determined by unpaired Student’s t -test. (B) Cells were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of TGFβ2 protein levels by western blot. β-actin was used as endogenous control. (C) ELISAs for TGFβ1 and TGFβ2 were performed with 24 hour conditioned supernates from HUVECs transfected with 20 nM of either control or miR-30b mimic. Data represents the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 secretion into cell culture supernate. * P = 0.044 as determined by unpaired Student’s t -test. (D) HUVECs were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of Smad2 phosphorylation by western blot.
    Figure Legend Snippet: (A) HUVECs were transfected with either control mimic (con) or miR-30b mimic (30b) and levels of TGFβ1 and TGFβ2 mRNA were assessed by qRT-PCR. Expression levels relative to control mimic transfected cells and normalized to β-actin expression are presented as the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 expression. * P < 0.05, ** P < 0.01 as determined by unpaired Student’s t -test. (B) Cells were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of TGFβ2 protein levels by western blot. β-actin was used as endogenous control. (C) ELISAs for TGFβ1 and TGFβ2 were performed with 24 hour conditioned supernates from HUVECs transfected with 20 nM of either control or miR-30b mimic. Data represents the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 secretion into cell culture supernate. * P = 0.044 as determined by unpaired Student’s t -test. (D) HUVECs were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of Smad2 phosphorylation by western blot.

    Techniques Used: Transfection, Control, Quantitative RT-PCR, Expressing, Over Expression, Western Blot, Cell Culture, Phospho-proteomics

    (A) JDP2 mRNA expression was assessed in HUVECs transfected with miR-30b mimic (20 nM) as compared to control by qRT-PCR. Data represents the mean ± SEM (n = 3) normalized to β-actin as endogenous control. * P = 0.016 as determined by unpaired Student’s t -test. (B) HUVEC were transfected with 50 nM of either control siRNA or ATF2 siRNA 1 or 2 and RNA was isolated at 48 hours post transfection. Levels of ATF2 and TGFβ2 mRNA were assessed by qRT-PCR with β-actin as endogenous control. Data presented is mean ± SEM (n = 2). Statistically significant decreases in ATF2 and TGFβ2 expression were seen in ATF2 siRNA treated cells as compared to control siRNA treated cells. * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by unpaired Student’s t -tests for each ATF2 siRNA compared to control siRNA. (C) Cells transfected with 5 nM of either control siRNA or ATF2 siRNA 1 were seeded onto growth factor reduced BME and the formation of capillary-like cord structures and number of loops was assessed after 24 hours. (D) A statistically significant increase in cord formation was observed in cells depleted of ATF2 through siRNA. Data represents the mean ± SEM (n = 2). * P = 0.041 as determined by unpaired Student’s t -test. (E) HUVECs were co-transfected with miRNA mimic (20 nM) and ATF2 siRNA 1 or 2 (50 nM) in the combinations displayed and cell lysates were collected at 48 hours post transfection and assessed for TGFβ2 mRNA expression. Data presented is mean ± SEM (n = 2). * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by ANOVA with post hoc analysis. (F) Cells were transfected as in (E) using miRNA mimic (20 nM) and ATF2 siRNA 1 (5 nM) and serum starved overnight in MCDB 131 with 0.5% FBS prior to protein expression analysis by western blot. Data is representative of expression levels observed in two independently performed experiments.
    Figure Legend Snippet: (A) JDP2 mRNA expression was assessed in HUVECs transfected with miR-30b mimic (20 nM) as compared to control by qRT-PCR. Data represents the mean ± SEM (n = 3) normalized to β-actin as endogenous control. * P = 0.016 as determined by unpaired Student’s t -test. (B) HUVEC were transfected with 50 nM of either control siRNA or ATF2 siRNA 1 or 2 and RNA was isolated at 48 hours post transfection. Levels of ATF2 and TGFβ2 mRNA were assessed by qRT-PCR with β-actin as endogenous control. Data presented is mean ± SEM (n = 2). Statistically significant decreases in ATF2 and TGFβ2 expression were seen in ATF2 siRNA treated cells as compared to control siRNA treated cells. * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by unpaired Student’s t -tests for each ATF2 siRNA compared to control siRNA. (C) Cells transfected with 5 nM of either control siRNA or ATF2 siRNA 1 were seeded onto growth factor reduced BME and the formation of capillary-like cord structures and number of loops was assessed after 24 hours. (D) A statistically significant increase in cord formation was observed in cells depleted of ATF2 through siRNA. Data represents the mean ± SEM (n = 2). * P = 0.041 as determined by unpaired Student’s t -test. (E) HUVECs were co-transfected with miRNA mimic (20 nM) and ATF2 siRNA 1 or 2 (50 nM) in the combinations displayed and cell lysates were collected at 48 hours post transfection and assessed for TGFβ2 mRNA expression. Data presented is mean ± SEM (n = 2). * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by ANOVA with post hoc analysis. (F) Cells were transfected as in (E) using miRNA mimic (20 nM) and ATF2 siRNA 1 (5 nM) and serum starved overnight in MCDB 131 with 0.5% FBS prior to protein expression analysis by western blot. Data is representative of expression levels observed in two independently performed experiments.

    Techniques Used: Expressing, Transfection, Control, Quantitative RT-PCR, Isolation, Western Blot

    (A) HUVECs were serum starved overnight in MCDB 131 with 0.5% FBS and stimulated with VEGF (50 ng/ml) in the presence or absence of Avastin (1 μg/ml) for 24 hours. Data represents the mean ± SEM (n = 2) for expression of TGFβ1 and TGFβ2 assessed by qRT-PCR relative to β-actin endogenous control. * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by ANOVA. (B) HUVECs were treated with 5 ng/ml of TGFβ2 for 3 days prior to seeding onto growth factor reduced BME for assessment of capillary-like cord formation after 24 hours. (C) A significant decrease in cord formation is observed in the TGFβ2 treated group. Data represents the mean ± SEM (n = 2). ** P = 0.0072 as determined by unpaired Student’s t -test. (D) HUVECs transfected with 1 nM control or miR-30b mimic were treated 4 hours post transfection with 0.8 μg/ml anti-TGFβ2 neutralizing antibody or rabbit IgG. Media was refreshed after 24 hours, again with rabbit IgG or anti-TGFβ2 antibody and cells were seeded onto growth factor reduced BME 24 hours later (ie. 48 hours post transfection) in media containing rabbit IgG or anti-TGFβ2 antibody. (E) Data represents the mean ± SEM (n = 3) of the number of capillary-like cord structures or number of loops formed after 24 hours on BME. * P < 0.05, ns denotes not significant as determined by ANOVA with post hoc analysis.
    Figure Legend Snippet: (A) HUVECs were serum starved overnight in MCDB 131 with 0.5% FBS and stimulated with VEGF (50 ng/ml) in the presence or absence of Avastin (1 μg/ml) for 24 hours. Data represents the mean ± SEM (n = 2) for expression of TGFβ1 and TGFβ2 assessed by qRT-PCR relative to β-actin endogenous control. * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by ANOVA. (B) HUVECs were treated with 5 ng/ml of TGFβ2 for 3 days prior to seeding onto growth factor reduced BME for assessment of capillary-like cord formation after 24 hours. (C) A significant decrease in cord formation is observed in the TGFβ2 treated group. Data represents the mean ± SEM (n = 2). ** P = 0.0072 as determined by unpaired Student’s t -test. (D) HUVECs transfected with 1 nM control or miR-30b mimic were treated 4 hours post transfection with 0.8 μg/ml anti-TGFβ2 neutralizing antibody or rabbit IgG. Media was refreshed after 24 hours, again with rabbit IgG or anti-TGFβ2 antibody and cells were seeded onto growth factor reduced BME 24 hours later (ie. 48 hours post transfection) in media containing rabbit IgG or anti-TGFβ2 antibody. (E) Data represents the mean ± SEM (n = 3) of the number of capillary-like cord structures or number of loops formed after 24 hours on BME. * P < 0.05, ns denotes not significant as determined by ANOVA with post hoc analysis.

    Techniques Used: Expressing, Quantitative RT-PCR, Control, Transfection

    Related Articles

    Transfection:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).

    Control:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).

    Quantitative RT-PCR:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).

    Expressing:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).

    Over Expression:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).

    Western Blot:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).

    Cell Culture:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).

    Phospho-proteomics:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).

    Isolation:

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2
    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).. Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).Secondary antibodies used were: goat anti-mouse IgG horse radish peroxidase (HRP) conjugate and goat anti-rabbit IgG HRP conjugate, both from Calbiochem (EMD Biosciences, La Jolla, CA).



    Similar Products

    99
    Danaher Inc anti tgfβ2 neutralizing antibody
    Figure 6. Neutralization and Knockdown of <t>TGFβ2</t> Results in Fewer Nephrons ex vivo.
    Anti Tgfβ2 Neutralizing Antibody, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+tgf%CE%B22+neutralizing+antibody/Anti-Lysozyme+antibody/pm29945868-291-38-41
    Average 99 stars, based on 1 article reviews
    anti tgfβ2 neutralizing antibody - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    92
    R&D Systems anti tgfβ2 neutralizing antibody
    (A) HUVECs were transfected with either control mimic (con) or miR-30b mimic (30b) and levels of TGFβ1 and <t>TGFβ2</t> mRNA were assessed by qRT-PCR. Expression levels relative to control mimic transfected cells and normalized to β-actin expression are presented as the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 expression. * P < 0.05, ** P < 0.01 as determined by unpaired Student’s t -test. (B) Cells were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of TGFβ2 protein levels by western blot. β-actin was used as endogenous control. (C) ELISAs for TGFβ1 and TGFβ2 were performed with 24 hour conditioned supernates from HUVECs transfected with 20 nM of either control or miR-30b mimic. Data represents the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 secretion into cell culture supernate. * P = 0.044 as determined by unpaired Student’s t -test. (D) HUVECs were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of Smad2 phosphorylation by western blot.
    Anti Tgfβ2 Neutralizing Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+tgf%CE%B22+neutralizing+antibody/TGF-beta+2+Antibody/pmc05627931-38-45-55
    Average 92 stars, based on 1 article reviews
    anti tgfβ2 neutralizing antibody - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    92
    Bio-Techne corporation tgf-beta 2 antibody
    (A) HUVECs were transfected with either control mimic (con) or miR-30b mimic (30b) and levels of TGFβ1 and <t>TGFβ2</t> mRNA were assessed by qRT-PCR. Expression levels relative to control mimic transfected cells and normalized to β-actin expression are presented as the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 expression. * P < 0.05, ** P < 0.01 as determined by unpaired Student’s t -test. (B) Cells were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of TGFβ2 protein levels by western blot. β-actin was used as endogenous control. (C) ELISAs for TGFβ1 and TGFβ2 were performed with 24 hour conditioned supernates from HUVECs transfected with 20 nM of either control or miR-30b mimic. Data represents the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 secretion into cell culture supernate. * P = 0.044 as determined by unpaired Student’s t -test. (D) HUVECs were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of Smad2 phosphorylation by western blot.
    Tgf Beta 2 Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+tgf%CE%B22+neutralizing+antibody/TGF-beta+2+Antibody/bio-techne+corporation___ab-12-na
    Average 92 stars, based on 1 article reviews
    tgf-beta 2 antibody - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    93
    R&D Systems anti tgfβ2 neutralizing antibody2
    (A) HUVECs were transfected with either control mimic (con) or miR-30b mimic (30b) and levels of TGFβ1 and <t>TGFβ2</t> mRNA were assessed by qRT-PCR. Expression levels relative to control mimic transfected cells and normalized to β-actin expression are presented as the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 expression. * P < 0.05, ** P < 0.01 as determined by unpaired Student’s t -test. (B) Cells were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of TGFβ2 protein levels by western blot. β-actin was used as endogenous control. (C) ELISAs for TGFβ1 and TGFβ2 were performed with 24 hour conditioned supernates from HUVECs transfected with 20 nM of either control or miR-30b mimic. Data represents the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 secretion into cell culture supernate. * P = 0.044 as determined by unpaired Student’s t -test. (D) HUVECs were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of Smad2 phosphorylation by western blot.
    Anti Tgfβ2 Neutralizing Antibody2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+tgf%CE%B22+neutralizing+antibody/TGF-beta+2+Antibody/pm10192809-63-14-26
    Average 93 stars, based on 1 article reviews
    anti tgfβ2 neutralizing antibody2 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Figure 6. Neutralization and Knockdown of TGFβ2 Results in Fewer Nephrons ex vivo.

    Journal: Development (Cambridge, England)

    Article Title: Hedgehog-GLI signaling in Foxd1- positive stromal cells promotes murine nephrogenesis via TGFβ signaling.

    doi: 10.1242/dev.159947

    Figure Lengend Snippet: Figure 6. Neutralization and Knockdown of TGFβ2 Results in Fewer Nephrons ex vivo.

    Article Snippet: E12.5 C57BL/6J kidneys were dissected out of embryos and placed onto transwell filters (0.4 μm, Falcon) in 6-well plates immersed in 2 mL DMEM/F12 supplemented with FBS, 50 μg/mL Transferrin (Sigma) and either: 1, 2 or 4 μg/mL anti-TGFβ2 neutralizing antibody (Abcam, ab10850); 4 μg/mL rabbit IgG (Cell Signaling, 2729S); 3 μM control MO (5’CTACTAATTGTCACAGCCGTCACGT) or 3 μM TGFβ2 splice inhibiting MO (5’ CCCACAACCAGAGCACAGGTTACCT).

    Techniques: Neutralization, Knockdown, Ex Vivo

    (A) HUVECs were transfected with either control mimic (con) or miR-30b mimic (30b) and levels of TGFβ1 and TGFβ2 mRNA were assessed by qRT-PCR. Expression levels relative to control mimic transfected cells and normalized to β-actin expression are presented as the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 expression. * P < 0.05, ** P < 0.01 as determined by unpaired Student’s t -test. (B) Cells were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of TGFβ2 protein levels by western blot. β-actin was used as endogenous control. (C) ELISAs for TGFβ1 and TGFβ2 were performed with 24 hour conditioned supernates from HUVECs transfected with 20 nM of either control or miR-30b mimic. Data represents the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 secretion into cell culture supernate. * P = 0.044 as determined by unpaired Student’s t -test. (D) HUVECs were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of Smad2 phosphorylation by western blot.

    Journal: PLoS ONE

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2

    doi: 10.1371/journal.pone.0185619

    Figure Lengend Snippet: (A) HUVECs were transfected with either control mimic (con) or miR-30b mimic (30b) and levels of TGFβ1 and TGFβ2 mRNA were assessed by qRT-PCR. Expression levels relative to control mimic transfected cells and normalized to β-actin expression are presented as the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 expression. * P < 0.05, ** P < 0.01 as determined by unpaired Student’s t -test. (B) Cells were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of TGFβ2 protein levels by western blot. β-actin was used as endogenous control. (C) ELISAs for TGFβ1 and TGFβ2 were performed with 24 hour conditioned supernates from HUVECs transfected with 20 nM of either control or miR-30b mimic. Data represents the mean ± SEM (n = 2). Overexpression of miR-30b significantly increases TGFβ2 secretion into cell culture supernate. * P = 0.044 as determined by unpaired Student’s t -test. (D) HUVECs were transfected with 20 nM of either control mimic (control) or miR-30b mimic (miR-30b) and protein lysates were collected after 48 hours for assessment of Smad2 phosphorylation by western blot.

    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).

    Techniques: Transfection, Control, Quantitative RT-PCR, Expressing, Over Expression, Western Blot, Cell Culture, Phospho-proteomics

    (A) JDP2 mRNA expression was assessed in HUVECs transfected with miR-30b mimic (20 nM) as compared to control by qRT-PCR. Data represents the mean ± SEM (n = 3) normalized to β-actin as endogenous control. * P = 0.016 as determined by unpaired Student’s t -test. (B) HUVEC were transfected with 50 nM of either control siRNA or ATF2 siRNA 1 or 2 and RNA was isolated at 48 hours post transfection. Levels of ATF2 and TGFβ2 mRNA were assessed by qRT-PCR with β-actin as endogenous control. Data presented is mean ± SEM (n = 2). Statistically significant decreases in ATF2 and TGFβ2 expression were seen in ATF2 siRNA treated cells as compared to control siRNA treated cells. * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by unpaired Student’s t -tests for each ATF2 siRNA compared to control siRNA. (C) Cells transfected with 5 nM of either control siRNA or ATF2 siRNA 1 were seeded onto growth factor reduced BME and the formation of capillary-like cord structures and number of loops was assessed after 24 hours. (D) A statistically significant increase in cord formation was observed in cells depleted of ATF2 through siRNA. Data represents the mean ± SEM (n = 2). * P = 0.041 as determined by unpaired Student’s t -test. (E) HUVECs were co-transfected with miRNA mimic (20 nM) and ATF2 siRNA 1 or 2 (50 nM) in the combinations displayed and cell lysates were collected at 48 hours post transfection and assessed for TGFβ2 mRNA expression. Data presented is mean ± SEM (n = 2). * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by ANOVA with post hoc analysis. (F) Cells were transfected as in (E) using miRNA mimic (20 nM) and ATF2 siRNA 1 (5 nM) and serum starved overnight in MCDB 131 with 0.5% FBS prior to protein expression analysis by western blot. Data is representative of expression levels observed in two independently performed experiments.

    Journal: PLoS ONE

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2

    doi: 10.1371/journal.pone.0185619

    Figure Lengend Snippet: (A) JDP2 mRNA expression was assessed in HUVECs transfected with miR-30b mimic (20 nM) as compared to control by qRT-PCR. Data represents the mean ± SEM (n = 3) normalized to β-actin as endogenous control. * P = 0.016 as determined by unpaired Student’s t -test. (B) HUVEC were transfected with 50 nM of either control siRNA or ATF2 siRNA 1 or 2 and RNA was isolated at 48 hours post transfection. Levels of ATF2 and TGFβ2 mRNA were assessed by qRT-PCR with β-actin as endogenous control. Data presented is mean ± SEM (n = 2). Statistically significant decreases in ATF2 and TGFβ2 expression were seen in ATF2 siRNA treated cells as compared to control siRNA treated cells. * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by unpaired Student’s t -tests for each ATF2 siRNA compared to control siRNA. (C) Cells transfected with 5 nM of either control siRNA or ATF2 siRNA 1 were seeded onto growth factor reduced BME and the formation of capillary-like cord structures and number of loops was assessed after 24 hours. (D) A statistically significant increase in cord formation was observed in cells depleted of ATF2 through siRNA. Data represents the mean ± SEM (n = 2). * P = 0.041 as determined by unpaired Student’s t -test. (E) HUVECs were co-transfected with miRNA mimic (20 nM) and ATF2 siRNA 1 or 2 (50 nM) in the combinations displayed and cell lysates were collected at 48 hours post transfection and assessed for TGFβ2 mRNA expression. Data presented is mean ± SEM (n = 2). * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by ANOVA with post hoc analysis. (F) Cells were transfected as in (E) using miRNA mimic (20 nM) and ATF2 siRNA 1 (5 nM) and serum starved overnight in MCDB 131 with 0.5% FBS prior to protein expression analysis by western blot. Data is representative of expression levels observed in two independently performed experiments.

    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).

    Techniques: Expressing, Transfection, Control, Quantitative RT-PCR, Isolation, Western Blot

    (A) HUVECs were serum starved overnight in MCDB 131 with 0.5% FBS and stimulated with VEGF (50 ng/ml) in the presence or absence of Avastin (1 μg/ml) for 24 hours. Data represents the mean ± SEM (n = 2) for expression of TGFβ1 and TGFβ2 assessed by qRT-PCR relative to β-actin endogenous control. * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by ANOVA. (B) HUVECs were treated with 5 ng/ml of TGFβ2 for 3 days prior to seeding onto growth factor reduced BME for assessment of capillary-like cord formation after 24 hours. (C) A significant decrease in cord formation is observed in the TGFβ2 treated group. Data represents the mean ± SEM (n = 2). ** P = 0.0072 as determined by unpaired Student’s t -test. (D) HUVECs transfected with 1 nM control or miR-30b mimic were treated 4 hours post transfection with 0.8 μg/ml anti-TGFβ2 neutralizing antibody or rabbit IgG. Media was refreshed after 24 hours, again with rabbit IgG or anti-TGFβ2 antibody and cells were seeded onto growth factor reduced BME 24 hours later (ie. 48 hours post transfection) in media containing rabbit IgG or anti-TGFβ2 antibody. (E) Data represents the mean ± SEM (n = 3) of the number of capillary-like cord structures or number of loops formed after 24 hours on BME. * P < 0.05, ns denotes not significant as determined by ANOVA with post hoc analysis.

    Journal: PLoS ONE

    Article Title: MicroRNA-30b controls endothelial cell capillary morphogenesis through regulation of transforming growth factor beta 2

    doi: 10.1371/journal.pone.0185619

    Figure Lengend Snippet: (A) HUVECs were serum starved overnight in MCDB 131 with 0.5% FBS and stimulated with VEGF (50 ng/ml) in the presence or absence of Avastin (1 μg/ml) for 24 hours. Data represents the mean ± SEM (n = 2) for expression of TGFβ1 and TGFβ2 assessed by qRT-PCR relative to β-actin endogenous control. * P < 0.05, ** P < 0.01, *** P < 0.001 as determined by ANOVA. (B) HUVECs were treated with 5 ng/ml of TGFβ2 for 3 days prior to seeding onto growth factor reduced BME for assessment of capillary-like cord formation after 24 hours. (C) A significant decrease in cord formation is observed in the TGFβ2 treated group. Data represents the mean ± SEM (n = 2). ** P = 0.0072 as determined by unpaired Student’s t -test. (D) HUVECs transfected with 1 nM control or miR-30b mimic were treated 4 hours post transfection with 0.8 μg/ml anti-TGFβ2 neutralizing antibody or rabbit IgG. Media was refreshed after 24 hours, again with rabbit IgG or anti-TGFβ2 antibody and cells were seeded onto growth factor reduced BME 24 hours later (ie. 48 hours post transfection) in media containing rabbit IgG or anti-TGFβ2 antibody. (E) Data represents the mean ± SEM (n = 3) of the number of capillary-like cord structures or number of loops formed after 24 hours on BME. * P < 0.05, ns denotes not significant as determined by ANOVA with post hoc analysis.

    Article Snippet: Primary antibodies used were: TGFβ2 (V, SC-90), ATF-2 (C-19, SC-187), and phospho-ATF-2 (F-1, SC-8398) from Santa Cruz Biotechnology (Santa Cruz, CA), phospho-Smad2 (S465/467) from Cell Signaling Technology (3101; Danvers, MA), Smad2 from Invitrogen (511300; Carlsbad, CA), β-Actin (clone AC-74) from Sigma-Aldrich (A5316; St. Louis, MO), anti-TGFβ2 neutralizing antibody (AB-12-NA) and Normal Rabbit IgG (AB-105-C) from R&D Systems (Minneapolis, MN).

    Techniques: Expressing, Quantitative RT-PCR, Control, Transfection